jdjdnnddnndnd jdjdnnddnndnd
  • 04-05-2021
  • Mathematics
contestada

Who can answer this question

Who can answer this question class=

Respuesta :

jalenmathis329 jalenmathis329
  • 04-05-2021
The answer is: c
Explination 30-9=21
Answer Link

Otras preguntas

The mean score on a Statistics exam is 88 points, with a standard deviation of 6 points. Apply Chebychev's Theorem to the data using k=2. Interpret the results
what is the answer to the equation-2n+3=8
Which is the better buy? 36-fluid-ounce carton of apple juice for $8.28 6-cup carton of apple juice for $5.76
Consider the following graph. List the ordered pairs corresponding to the points in the graph?
Solve the quadratic equation by completing the square.4a²- 48a +52 = 0a= _,_
For each table below, describe whether the table represents a function that increasing or decreasing.
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
You are given the circumference of the circle and the measure of the central angle ACB. Find the length of arc AB.circumference = 36 feet; m ZACB= 40"The length
This week Lucas got a promotion at work that came with a 2 % pay increase. If now his monthly salary is $ 2601 , how much was he making before the raise?Ente
A circle has a radius of 5.5A. A sector of the circle has a central angle of 1.7 radians. Find the area of the sector. Do not round any intermediate computation