doublejaboveall7028 doublejaboveall7028
  • 04-02-2018
  • Business
contestada

A form of legal organization in which a business association made up of two or more persons is formed for the purposes of carrying on as co-owners

Respuesta :

Ashleyburnett81
Ashleyburnett81 Ashleyburnett81
  • 06-02-2018
partnership is the answer
Answer Link

Otras preguntas

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
I need the answer to this question A.Or B.OrC.Or D
What is the missing length? y 16 km area = 144 km y = kilometers
Solve triangles using the law of cosines . Find BC
The Homecoming committee wants to raise between $1500 and $2000 at the dance.They have already saved $800 to put towards the dance. If tickets are $20 each, how
QuestionSolve the inequality 37v < -18 and write the solution in interval notation, using improper fractions if necessary.
find a slope of the line that passes through (6,8) and (95,86)
Can you please help me solve this? It is for HW
Don’t know the concept neither do I understand this question
For the following set of data, find the number of data within 1 population standarddeviation of the mean.68, 68, 70, 61, 67, 71, 63, 67