Nikkilysun123 Nikkilysun123

03-02-2018
Mathematics

contestada

(2x-3)(4-3x) Find the product of the binomials. A) 72x2 B) 11x2 - 12 C) 8x2 - 18x + 9 D) -6x2 + 17x - 12

Respuesta :

03-02-2018

(2x-3)(4-3x)
8x-6x^2-12+9x
answer=-6x^2+17x-12

Answer Link

abscisa15 abscisa15

03-02-2018

(2x-3)(4-3x) = 8x - 6x² -12 +9x = -6x² +17x -12

Answer Link

Otras preguntas

who invented the theory of relativity

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

crystal lattice definition

If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system

The temperature on a cloudy night is likely to be __________ those on a clear night all other factors being equal

How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie

What is the distance between points (21, -32) and (-3, -25)?

When you prepare to make a left turn from a one-way road into a two-way road, you must:?