iftyuddin13oszi78 iftyuddin13oszi78

03-08-2017
Mathematics

contestada

When simplified, the expression (x ^1/8) (x^3/8) is 12. Which is a possible value of x?

Respuesta :

sergibcnusa sergibcnusa

03-08-2017

(x ^1/8) (x^3/8) = x^4/8=x^1/2 = 12, x = 12^2 = 144

x=144

Answer Link

03-08-2017

the possible value of x is 144

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which function has the solution set shown in the graph?

Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re

What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define

Why were senators able to amass more power and influence than congressmen during the gilded age?

Which of the following is a run-on sentence?

help pls :) I am stuck on this chemistry question about percentage yields!

Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to

The length of the shorter base in an isosceles trapezoid is 4 in, its altitude is 5 in, and the measure of one of its obtuse angles is 135°. Find the area of th

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side