tiger600578 tiger600578

04-03-2017
Mathematics

contestada

eliminating possible answer
(1,- 1)
(- 5, 1)
(0, 3)
(- 1,1)

problem
- 5x- 8y=17
2x- 7y=- 17

Respuesta :

Trex111 Trex111

04-03-2017

(-5,1)
-5×-5=25-8 (1)=17
2×-5=-10-7 (1)=-17

Answer Link

Otras preguntas

True or false? Slovakia is a land locked country, surrounded by 5 other countries.

An arch for a bridge over a highway is in the form of a semi ellipse. The top of the arch is 35 feet above ground (the major axis). What should the span of th

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Help with questions A-C Brainliest Answer GIVEN

If we increase our food intake, we generally gain weight. Nutrition scientists can calculate the amount of weight gain that would be associated with a given in

Erlk has 2 bags of bird seed. One bag has 10 pounds of seed, and the other bag has 8 pounds. Write and solve and equation to find how many pounds of bird seed a

4) An expression containing only numbers is called _ _ _ _ _ _ _ _ _.

A rectangular bin is going to be made with a volume of 646 cm^3. The base of the bin will be a square and the top will be open. The cost of the material for the

Smallpox is no longer a threat to anyone in the United States. And the vaccination against it is unpleasant and, in rare cases, life-threatening. conclusion : W

Simplify. 6 √20 - 3 √8 (Please explain the steps so I can better understanding thank you:))