austingaine austingaine
  • 02-06-2022
  • Biology
contestada

where is Ground tissue is found in plants

Respuesta :

AcelaaTrack
AcelaaTrack AcelaaTrack
  • 02-06-2022
Ground tissue are found between the vascular and dermal issues of the plant.
Answer Link

Otras preguntas

A swimming pool is to be drained. The pool is shaped like a rectangular prism with length 30 feet, wide 18 ft, and depth 4ft. Suppose water is pumped out of the
The discount rate is the rate of interest at which: Question 12 options: 1) Federal Reserve Banks lend to commercial banks. 2) savings and loan associatio
Which of these equations has a y-intercept of 4? A. y=x+4 B. y=x-4 C. y=4x D. y+4=x
Which functions have a horizontal asymptote? Y = f(x) y = h(x) y = g(x) y = k(x) On a coordinate plane, 4 exponential functions are shown. Y = f (x) approaches
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
what is the value of x? enter your answer in the box
The three legged stool represents
what is the midpoint between (-1, -5) and (-5, 9)
A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and it appears
What is sound energy? Give two examples.