terrel201954 terrel201954

01-04-2022
Mathematics

contestada

Convert the following fraction to a decimal 20/16

Respuesta :

bohemianrh81 bohemianrh81

01-04-2022

Answer:

1.25

Step-by-step explanation:

Answer Link

Otras preguntas

Nigeria’s economy has relied on its oil industry to create jobs . When world oil prices dropped , their economy collapsed. This is a problem primarily caused by

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?

Racing other drivers, tailgating, and attempting to beat a train to a railroad crossing are possible consequences of __________ when driving while impaired. A.

An element's atomic number is 64. How many protons would an atom of this element have?

When did the eastern part of the Roman Empire fall?

What is the distance between 407 squared and negative 68 squared

you rent a well-lit flat in philidelpia for $1,080 per month. your landlord, knowing that new apatments are being built nearby, decreases you rent by 3%each yea