jjackiebhhhiu jjackiebhhhiu

01-02-2022
Social Studies

contestada

Why does the government of Africa want to build the trans east African Highway between Cairo and Cape Town?

Respuesta :

oninonon167 oninonon167

01-02-2022

Answer:

They aim to promote trade and alleviate poverty in Africa through highway infrastructure development and the management of road-based trade corridors. The total length of the nine highways in the network is 56,683 km (35,221 mi).

Answer Link

Otras preguntas

Many worship services include a speech given by a church leader. this speech is called a

List and briefly describe each of the five strength training principles. (Site 1)

who invented the glass harmonica

Please explain to me how to solve this

Which component of a phospholipid is found in the interior of a lipid bilayer?

IS THIS A COMMON KNOWLEDGE OR NEEDS CITATION .In December of 2003, Joan Didion lost her husband of forty years, John Gregory Dunne, after a massive heart attack

Can you help me to find this answer, please, I need help

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which statement is true for a career as a graphic designer?

Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1