alifewithstory alifewithstory
  • 02-07-2021
  • Mathematics
contestada

which values are soloutions to the inequality -3x - 4 < 2 ? check all of the boxes that apply

Respuesta :

erinna erinna
  • 07-07-2021

Given:

The inequality is:

[tex]-3x-4<2[/tex]

To find:

The values that are solutions to the given inequality.

Solution:

We have,

[tex]-3x-4<2[/tex]

Adding 4 on both sides, we get

[tex]-3x-4+4<2+4[/tex]

[tex]-3x<6[/tex]

Divide both sides by -3 and change the inequality sign because -3 is a negative value.

[tex]\dfrac{-3x}{-3}>\dfrac{6}{-3}[/tex]

[tex]x>-2[/tex]

Therefore, all the real values greater than -2 are the solutions to the given inequality.

Answer Link

Otras preguntas

why is it critical to your cells to be near capillaries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A vehicle is only 15% efficient. What happened to the other 85%?
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Explain who or what "Año Viejo" is and its significance.
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
What were the driving forces behind the industrial revolution
How do you put allele in a sentence
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?