mreyes0179 mreyes0179
  • 03-06-2021
  • Mathematics
contestada

Does anyone know how to do this?

Does anyone know how to do this class=

Respuesta :

586769 586769
  • 03-06-2021

Answer:

sorry ma g dont know this but my boy aaron yeager is smart he can help u 839

Step-by-step explanation:

Answer Link

Otras preguntas

How did laws controlling slaves, called Slave Codes, influence opportunities for slaves
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
some symptoms of dementia are progressive decreases in memory, thinking, and behavior. what are the leading causes of dementia in older adults?
Which of the following is NOT a weakness of the Electoral College? the winner of the popular vote may not win the Electoral College vote The Electoral College d
15. Given: 9° a. Simplify the expression for y = 3. b. Construct Arguments Will the value of the given expression vary depending on y? Explain. I need help and
[tex]what 7.99+90[/tex]
If 4x = 32, find the value of 35 - 5x 0-5 03 0-3 O 5
The indigenous people of North Africa before the Arab invasions are known as the Question 14 options: Ottomans. bedouins. Berbers. Algerians.
What can be used to make accurate predictions? Abe O body details text structure O author's purpose O text evidence
whats the answer to1.​