angieedarlingg angieedarlingg

02-06-2021
Mathematics

contestada

pleaseee help me answer this question

pleaseee help me answer this question class=

Respuesta :

hamptongrazi hamptongrazi

02-06-2021

Answer:

I believe it is 48

Step-by-step explanation:

Answer Link

Otras preguntas

Which section of an article would you look at to find out if assessors were blinded to treatment assignment?

What is the value of c?

the value x+x(x×) when x = 2

What is one key difference between the radiation and convection zones?

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability

Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What brings the u.s. into this war? - 1. economic factors (natural resources and new markets 2. nationalistic factors (competition to create an empire/prove you

The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis