Seudónimo Seudónimo

04-05-2021
Chemistry

contestada

Please help with my Science

What is the man’s mass while on Mars? Explain your answer.

Respuesta :

animesimp06 animesimp06

04-05-2021

Answer:

The gravity on the surface of Mars is 0.376 g - so everything weighs 37.6% of what it would on Earth. an average 88kg man weighs about 33kg on Mars.

Explanation:

Answer Link

justme1510 justme1510

05-05-2021

33kg ..........................

Answer Link

Otras preguntas

9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

20 POINTS - MONOHYBRID CROSS Complete the following monohybrid cross. Two parents that are heterozygous for brown eyes. Be sure to identify the genotypes of t

Under the articles of confederation, political power and authority ultimately rested with the ________.

Why silk is called queen of fiber?

a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w

Is the interaction that occurs among elements of the department of defense engaged us government?

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

To what does the poet compare the lass? A. nomads B. musicians C. birds D. sailors

Find the product. (7x-2) (x+y)