babygirlnylah babygirlnylah
  • 04-05-2021
  • Mathematics
contestada

I need help writing an equation with x,y for the table.

I need help writing an equation with xy for the table class=

Respuesta :

sugagummysmile202050
sugagummysmile202050 sugagummysmile202050
  • 04-05-2021

Answer:

Number 5 is ' 2(x) + 1 = y '

I dont know how to solve number 6.

Step-by-step explanation:

you take your x variables and compare them to each other and compare them to the y variables. each x variable goes into the y variable 2 times. thats where the 2(x) comes from. then once yiu do that for all your x variables, you must look to see what they have in common. in this case all of them are one digit less than the y value. so you add that to your equation and it become ' 2(x) + 1 = y '

Answer Link

Otras preguntas

What are some methods used by Mussolini to rise to power?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Write expression using the distributive property to find the product of 7 times 63
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
who fought against each other in the crusades?
how do i find the angles on a kite?
What was George Washington's nickname?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
How many years does an apple tree live useful?