elizabeth4tamayo elizabeth4tamayo
  • 01-05-2021
  • History
contestada

Was the conflict between North and South Korea (1950-1953) a Korean War, or an American War fought abroad?

Respuesta :

hamburgerhelperOG
hamburgerhelperOG hamburgerhelperOG
  • 01-05-2021
The war began on 25 June 1950 when North Korea invaded South Korea following clashes along the border and insurrections in the south. The war ended unofficially on 27 July 1953 in an armistice. Hancha was there name
Answer Link

Otras preguntas

How many years does an apple tree live useful?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
What is the sum of 6/10 plus 7/12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
4(3-5)=-2(8-z)-6z what is z
What would be the most likely effect of one company buying a competitor?