eclarer8128 eclarer8128
  • 01-04-2021
  • Mathematics
contestada

You place two wooden support beams under a shelf, as shown. Find the value of x. (3x-13 ) (x- 3) x=

Respuesta :

abidemiokin
abidemiokin abidemiokin
  • 02-04-2021

Answer:

x = 49

Step-by-step explanation:

Fins the similar diagram attached;

The sum of the angles is 180 degree since they lie on the same straight line. Hence;

3x - 13 + x - 3 = 180

Collect the like terms;

3x+x -13 - 3 = 180

4x - 16 = 180

4x = 180 + 16

4x = 196

x = 196/4

x = 49

Hence the value of x is 49

Note that the values in question is different from that of diagram but the diagram is similar to what we need

Ver imagen abidemiokin
Answer Link

Otras preguntas

why did Mr Collins come to the Bennet family looking for a wife?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
why is the square root of a perfect square always rational
solve the simultaneous equation 4x+7y=1 3x+10y=15
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
A generator stores electric current. Explain why you agree or disagree with this statement
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
i need help with this question
when Jefferson took office he did what