rbaliscao
rbaliscao rbaliscao
  • 02-03-2021
  • Chemistry
contestada

What is the skin's natural oil?
a. sweet
b. Melanin
c. sebum
d. vegetable oil

help​

Respuesta :

jadejac2021
jadejac2021 jadejac2021
  • 02-03-2021

Answer:

C. Sebum

Explanation:

C. Sebum

Answer Link

Otras preguntas

Really need some helpUse the diagram below. Write AD/AB in simplest form.
We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A major difference between major depressive disorder and bipolar disorder is that only in bipolar disorder do people have _____. a. hallucinations or delusions
The federalist papers were published in 1787 and 1788 to help gain support for
please help if you know, thanks!
Solve the equation by the method of your choice. StartFraction 1 Over x EndFraction plus StartFraction 1 Over x plus 4 EndFraction equals one half The solution
What do the tympanic membranes do for the frog?
help pls :) I am stuck on this chemistry question about percentage yields!
Suppose 91% of students chose to study French their sophomore year, and that meant that there were 819 such students. How many students chose not to take French