devon352 devon352
  • 03-02-2021
  • Chemistry
contestada

What type of atom is formed by the loss of one or more electrons?

Respuesta :

hallcecilia2003 hallcecilia2003
  • 03-02-2021

An atom that loses one or more valence electrons to become a positively charged ion is known as a cation, while an atom that gains electrons and becomes negatively charged is known as an anion.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
2ln(5x)=8 solve for x
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
Do all your pet's offspring look the same? If no, then explain why they look different.
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
i need help with this question
i need help with #3
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12