Seudónimo Seudónimo
  • 02-02-2021
  • History
contestada

*cries* i need help :(

cries i need help class=

Respuesta :

angelinahernandezcsv angelinahernandezcsv
  • 02-02-2021

Answer:

The Correct answer is D

Explanation:

Answer Link

Otras preguntas

What did Jimmy Carter base his views on foreign-policy?
Jay belsky believes that a major source of family stress is that society does not
What type of government did germany, italy, and japan have in the 1930s? (world war ii and postwar america unit, lesson 1)?
1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help
I need help on exterior angles!
How did censorship and propaganda help fortify post ww1 dictatorships?
In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
CAN SOMEONE HELP ME PLEASE ?
The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1