Seudónimo Seudónimo
  • 03-04-2020
  • Mathematics
contestada

Pythagorean theorem (picture provided)

Pythagorean theorem picture provided class=

Respuesta :

TheAnimeGirl
TheAnimeGirl TheAnimeGirl
  • 03-04-2020

The answer is of option D.

Hope this will help u...:)

Ver imagen TheAnimeGirl
Answer Link
beansboeck
beansboeck beansboeck
  • 03-04-2020
The answer is definitely D:)
Answer Link

Otras preguntas

a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
How well did feudalism establish order in the Middle ages?
how do you say theatre in Spanish
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
what are 2 points on the graph for 6x-5y=25