emilylou218 emilylou218
  • 03-07-2016
  • Mathematics
contestada

What is the equation in standard form of a parallel line that passes through (0,-2)?

Respuesta :

AL2006
AL2006 AL2006
  • 03-07-2016
'Parallel' means parallel TO something else.  A single line all by itself
is not "a parallel line", until we know the other line that it's parallel TO.

There are an infinite number of lines that pass through (0, -2). 
Give us another line, and we'll find the one that's parallel to it.
Answer Link

Otras preguntas

Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
four yardequal Blank feet
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Do you think then solid can undergo convection
a summary about concussions
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
Compliant is to stubborn as excited is to