umurrieHbettytayla
umurrieHbettytayla umurrieHbettytayla
  • 02-06-2016
  • Biology
contestada

A lack of some basic biological requirement such as water, which produces a drive to obtain that requirement, is known as the?

Respuesta :

Аноним Аноним
  • 06-06-2016
Drive reduction approach to motivation, this theory states that when an individual has been deprived of biological resources such as energy, water or sleep, others. They tend to result to impulse or drive. These basic needs arise an action to obtain this need is required. 
Answer Link

Otras preguntas

a summary about concussions
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
does radiation need a phase of matter to travel with?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve the equation -10 + 3x + 5x = -56 ? ??
Please help solve, thanks in advance!
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn